HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (82) Citing Articles via Google Scholar Google Scholar Articles by Gamba, G. Search for Related Content PubMed PubMed Citation Articles by Gamba, G.

Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters

Molecular Physiology Unit, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán and Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Mexico City, Mexico

ABSTRACT

I. INTRODUCTION

II. MOLECULAR BIOLOGY

A. Na+-Coupled Chloride Cotransporters

1. The thiazide-sensitive Na+–Cl– cotransporter

2. The apical bumetanide-sensitive Na+-K+-2Cl– cotransporter

3. The basolateral bumetanide-sensitive Na+-K+-2Cl– cotransporter

B. K+-Coupled Chloride Cotransporters

1. The K+-Cl– cotransporter KCC1

2. The K+-Cl– cotransporter KCC2

3. The K+-Cl– cotransporter KCC3

4. The K+-Cl– cotransporter KCC4

C. Orphan Members

D. Genes and Promoter Characteristics

1. Na+-coupled chloride cotransporters

2. The K+-coupled chloride cotransporters

E. Phylogenetic and Sequence Comparison

III. FUNCTIONAL PROPERTIES

A. Thiazide-Sensitive Na+-Cl– Cotransporter

B. Apical Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

C. Basolateral Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

D. K+-Cl– Cotransporter 1

E. K+-Cl– Cotransporter 2

F. K+-Cl– Cotransporter 3

G. K+-Cl– Cotransporter 4

H. Orphan Members

IV. STRUCTURE-FUNCTION RELATIONSHIPS

A. Na+-Coupled Chloride Cotransporters

1. The Na+-coupled chloride cotransporter forms homodimers

2. Affinity modifier domains or residues in the Na+-K+-2Cl– cotransporter

3. Cysteine scanning mutagenesis in Na+-K+-2Cl– cotransporter

4. Regulatory motifs in BSC2/NKCC1 amino-terminal domain

5. The thiazide-sensitive Na+-Cl– cotransporter

B. K+-Coupled Chloride Cotransporters

V. PHYSIOLOGICAL ROLES

A. Thiazide-Sensitive Na+-Cl– Cotransporter

B. Apical Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

1. Molecular physiology of salt reabsorption by TALH

2. Regulation of the Na+-K+-2Cl– cotransporter

C. Basolateral Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

D. K+-Cl– Cotransporter 1

E. K+-Cl– Cotransporter 2

F. K+-Cl– Cotransporter 3

G. K+-Cl– Cotransporter 4

VI. PATHOPHYSIOLOGICAL ROLES

A. Gitelman's Disease

B. Bartter's Disease

C. Anderman's Disease

D. Gordon's Disease

E. Potential Role in Polygenic Diseases

1. Arterial hypertension

2. Epilepsy

3. Cancer

4. Osteoporosis

VII. CONCLUSIONS AND PERSPECTIVE

ACKNOWLEDGMENTS

REFERENCES

	ABSTRACT

Top Next References

	I. INTRODUCTION

Top Previous Next References

 
In absorptive and secretory epithelia, transcellular ion transport depends on specific plasma membrane proteins for mediating ion entry into and exit from cells. In basolateral membrane of almost all epithelia (with exception of choroidal plexus), sodium exit and potassium entrance occur through Na⁺–K⁺–ATPase, generating electrochemical gradients that constitute a driving force for Na⁺ influx and K⁺ efflux. Transport of these ions following their gradients can be accomplished by specific ion channels, allowing membrane passage of ions alone or by transporters in which Na⁺ or K⁺ transport is accompanied by other ions or solutes by means of several different solute transporters. These membrane proteins are known as secondary transporters because ion or molecule translocation is not dependent on ATP hydrolysis but rather on gradients generated by primary transporters. A secondary transport mechanism that is very active in trancellular ion transport in epithelial cells is one in which cations (Na⁺ or K⁺) are coupled with chloride, with a stoichiometry of 1:1; therefore, ion translocation produces no change in transmembrane potential. For this reason, these transporters are known as electroneutral cation-Cl^– coupled cotransporters. In addition to being heavily implicated in ion absorptive and secretory mechanisms, electroneutral cation-Cl^– coupled cotransporters play a key role in maintenance and regulation of cell volume in both epithelial and nonepithelial cells. Because Na⁺ influx and K⁺ efflux by electroneutral cotransporters are rapidly corrected by Na⁺–K⁺–ATPase, the net effect of its activity is Cl^– movement inside or outside cells. This is known to be accompanied by changes in cell volume. Finally, a variety of new physiological roles for electroneutral cotransporters are emerging. One example is regulation of intraneuronal Cl^– concentration, thus modulation of neurotransmission (77).

Four groups of electroneutral cotransporter systems have been functionally identified based on cation(s) coupled with chloride, stoichiometry of transport process, and sensitivity to inhibitors. These systems include 1) the benzothiadiazine (or thiazide)-sensitive Na⁺–Cl^– cotransporter, 2 and 3) the sulfamoylbenzoic (or bumetanide)-sensitive Na⁺–K⁺–2Cl^– and Na⁺–Cl^– cotransporters, and 4) the dihydroindenyloxy-alkanoic acid (DIOA)-sensitive K⁺–Cl^– cotransporter. There is some overlap in sensitivity to inhibitors in the last two groups because Na⁺–K⁺–2Cl^– and K⁺–Cl^– cotransporters can be inhibited by high concentration of DIOA or loop diuretics, respectively; however, affinity for inhibitor and the cation coupled with chloride clearly differentiate between both groups of transporters. Physiological evidence for these transport mechanisms became available at the beginning of the 1980s (341) (95, 138, 237), and a remarkable amount of information was generated in the following years by characterizing these transport systems in many different cells and experimental conditions.

Major advances have been made in the past decade in molecular identification and characterization of solute carriers. To date, Human Genome Organization (HUGO) Nomenclature Committee Database recognizes 43 solute carries (SLC) families, which include a total of 298 transporter genes encoding for uniporters (passive transporters), cotransporters (coupled transporters), antiporters (exchangers), vesicular transporters, and mitochondrial transporters (175). This amount of solute carrier genes represents ~1% of the total pool of genes that have been calculated to compose human genome. One of the families that was identified at the molecular level during the last decade contains all genes encoding for electroneutral cation-Cl^– coupled cotransporters and is known as the SLC12 family (173). With molecular identification of the first members, several tools became available to isolate remaining members and to study these proteins from molecular organization of their genes, to their role in monogenic and polygenic disease. To date, seven clearly characterized genes and two orphan members compose this family. It is the major goal of this review to present comprehensive information of knowledge generated in SLC12 family as a consequence of cloning cDNAs encoding its different members. Information is divided into five major subjects that include 1) molecular biology of each gene, 2) functional properties of the recombinant proteins, 3) insights into structure-function analysis, 4) physiological role of each cotransporter, and 5) involvement of electroneutral cotransporters in pathophysiology of monogenic and polygenic disease.

	II. MOLECULAR BIOLOGY

Top Previous Next References

 
After the discovery of electrically silent cotransport mechanisms in mammalian cells and tissues 25 years ago (138, 340), several laboratories undertook unrewarded attempts to identify the proteins responsible for such a transport system (94, 107, 121, 197, 251, 406). However, the major breakthrough in this field came in the early 1990s from two different laboratories that were able to identify the genes responsible for Na⁺–Cl^– (136, 137) and Na⁺–K⁺–2Cl^– cotransporters (136, 311, 440). As eloquently predicted by Homer Smith in his remarkably elegant book about fish and philosophy (378), cDNA encoding these proteins were identified first from fish sources, because tissue from these animals proved to be an ideal source of proteins and mRNA, due to the robust expression of these transport systems. Thereafter, homology-based approaches were used to identify corresponding orthologs from mammalian tissues.

A. Na⁺-Coupled Chloride Cotransporters

1. The thiazide-sensitive Na⁺–Cl^– cotransporter

The first electroneutral cotransporter protein identified at the molecular level was the thiazide-sensitive Na⁺–Cl^– cotransporter from Pseudopleuronectes americanus (winter flounder) urinary bladder (137). Original evidence that suggested the existence of a Na⁺–Cl^– cotransporter was obtained by Renfro (340), who observed that sodium and chloride were actively transported by the flounder's urinary bladder in which Renfro thought there was an electrically silent mechanism. Subsequently, he was able to demonstrate in isolated perfused urinary bladder a clear interdependence of active Na⁺ and Cl^– transport that was independent of transepithelial voltage (341). A few years later, pharmacological properties of this Na⁺–Cl^– cotransport system were defined by Stokes et al. in two studies (389, 388) in which the investigators observed in bladder preparations that mucosal-to-serosal Na⁺ and Cl^– transport were completely inhibited in a dose-dependent fashion by thiazide-type diuretics hydrochlorothiazide and metolazone. These drugs had no effect when applied to the serosal side of the bladder. It was also shown that the Na⁺–Cl^– cotransporter was not inhibited by barium, acetazolamide, furosemide, amiloride, DIDS, ouabain, and diphenolamine carboxylate (DPC). In fact, in the absence of a mammalian tissue to test the potency of thiazides, winter flounder urinary bladder was suggested as a model to assess effectiveness of this class of diuretics (244). In addition to these observations, another similarity observed between mammalian distal convoluted tubule (DCT) and winter flounder urinary bladder was that in both epithelia, inhibition of Na⁺–Cl^– cotransporter with thiazides resulted in increased calcium absorption (63, 452). In the marine teleost, urinary bladder is functionally and anatomically an extension of mesonephric kidney, that is, the embryologically derived form of mesoderm, representing a kind of distal tubule located outside the kidney (227). All this information was taken by Hebert and co-workers (137) to identify a clone from a winter flounder urinary bladder size-fractionated, poly(A)⁺–RNA directional cDNA library constructed into pSPORT1, which encodes a thiazide-sensitive Na⁺–Cl^– cotransporter using a functional expression strategy in Xenopus laevis oocytes. The cloning strategy was based on the ability of mRNA isolated from winter flounder urinary bladder to give rise to thiazide-(metolazone)-sensitive Cl^–-dependent ²²Na⁺ uptake when injected into X. laevis oocytes. Consistent with previous observations, it was shown that furosemide, acetazolamide, ouabain, amiloride, and DIDS had no effect on cotransporter activity. The 3.7-kb cDNA clone was named flTSC for flounder thiazide-sensitive cotransporter. As shown in Table 1, nucleotide sequence predicted an open reading frame (ORF) of 3,069 bp encoding a protein of 1,023 amino acid residues with a core molecular mass of 112 kDa. Hydropathy analysis following the algorithm proposed by Kyte and Doolittle (226) revealed the basic structure of the Na⁺-coupled chloride cotransporters shown in Figure 1, featuring a central hydrophobic domain containing 12 -helices compatible with putative transmembrane-spanning segments that is flanked by a short hydrophilic amino-terminal domain and a long predominantly hydrophilic carboxy-terminal domain. The latter two domains are presumably located within the cell. There is a long hydrophilic loop connecting transmembrane segments 7 and 8, exhibiting three putative N-glycosylation sites that are located toward the putative extracellular side of the protein. Tissue distribution analysis by Northern blot in winter flounder revealed expression of a 3.7-kb transcript in urinary bladder and a shorter 3.0-kb message in several tissues including gonads, intestine, eye, brain, skeletal muscle, and heart (137). It was also observed that this shorter transcript of 3.0 kb is the result of an alternative splicing mechanism, in which the first 229 residues encoding the amino-terminal domain and the first three putative transmembrane segments are lost. The functional consequence of such splicing has not been resolved (276).

View larger version (29K): [in this window] [in a new window]   FIG. 1. Proposed topologies for members of the electroneutral cation-chloride cotransporter family. SLC12A1–3 in black is the topology proposed for Na+-coupled chloride cotransporters BSC1/NKCC2, BSC2/NKCC1, and TSC. SLC12A4–7 in blue depict the topology proposed for K+-coupled chloride cotransporters KCC1, KCC2, KCC3, and KCC4. SLC12A8/CCC9 in red corresponds to topology for the orphan member CCC9. This is the most distant member, because there are only 11 predicted transmembrane segments and the carboxy-terminal domain is predicted to be located outside the cell. SLC12A9/CIP in green is the topology proposed for an orphan member known as CIP or cotransporter interacting protein and resembles the topology for KCCs cotransporters.

Rabbit and human TSC are longer than rat and mouse orthologs due to presence of 17–26 amino acid residues in the carboxy-terminal domain that are not present in rat and mouse TSC (Fig. 2). These extra residues were shown to be encoded by a separate exon (exon 20) in humans that is not present in mouse or rat. However, two distinct Homo sapien TSC mRNA sequences have been deposited into the genome database (www.ncbi.nlm.nih.gov). The sequence from Mastroianni et al. (265) (X91220) exhibits 1,021 residues, including 17 extra amino acids not present in rat or mouse TSC sequence. In contrast, one sequence deposited by Simon et al. (377) (NM_000339) exhibits 1,030 residues with 26 extra residues not present in rat or mouse (Table 1). As shown in Figure 2, rabbit TSC sequence is similar to the sequence reported by Simon et al., because the 26 extra residues from exon 20 are present in this rodent. BLAST search of genomic databases with 78 bp encompassing the DNA sequence encoding the 26-amino acid fragment revealed that this sequence aligns perfectly with a fragment of the RP11–325K4 clone containing full sequence of human chromosome 16, suggesting that exon 20 indeed encodes 26 residues, instead of 17. It is noteworthy that in humans there is a putative protein kinase A (PKA) site (RPS) within the extra fragment that is not present in rabbit, mouse, or rat TSC.

View larger version (16K): [in this window] [in a new window]   FIG. 2. Sequence alignment of the carboxy-terminal domain fragment in TSC from several species, from residues 789–826 of human TSC. Human 1 and human 2 correspond to sequences deposited in Genebank by Simon et al. (Genebank accession no. NM_000339) and Mastroianni et al. (Genebank accession no. X91220), respectively. The box in human 1 sequence highlights a putative protein kinase A phosphorylation site.

Two genes encoding bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporters were identified as part of the SLC12 family. These genes are known as SLC12A1 and SLC12A2 and encode for the apical and basolateral isoforms, respectively. The SLC12A1 gene is a renal-specific Na⁺-K⁺-2Cl^– cotransporter isoform exclusively expressed in the apical membrane of thick ascending limb of Henle (TALH). The cDNA encoding this cotransporter was simultaneously identified from mammalian kidney in 1994 by two groups. Payne and Forbush (311) screened rabbit cortical and medullary cDNA libraries inserted in ZAP using a ³²P-DNA random-primed probe constructed from cDNA encoding the T84 human colonic basolateral Na⁺-K⁺-2Cl^– cotransporter. As shown in Table 1, a full-length clone of 4,750 bp was identified, with an ORF of 3,297 bp encoding a protein of 1,099 amino acid residues. Tissue distribution analysis by Northern blot revealed the presence of transcripts only in total RNA extracted from kidney. No functional expression was presented, but based on high homology with basolateral Na⁺-K⁺-2Cl^– cotransporter, it was proposed that the isolated clone encoded the apical isoform of this cotransporter. Because in 1994 this group first cloned the basolateral isoform (see later) that was named NKCC1, their clone encoding the apical, renal-specific isoform of the Na⁺-K⁺-2Cl^– cotransporter was denominated NKCC2. Simultaneously, Gamba et al. (136) isolated a 4,546-bp clone from a size-fractionated cDNA library constructed from poly(A)⁺ RNA extracted from inner stripe of outer medulla of rat kidney. The library was screened using a random-primed ³²P-DNA probe derived from the coding region of flTSC transporter. The 3,285-bp ORF encodes a 1,095-residue protein exhibiting 93% identity with rabbit NKCC2. Tissue distribution by Northern blot analysis also showed that transcripts were present only in total RNA from kidney; all other tissues were negative. Functional expression analysis in X. laevis oocytes demonstrated that the isolated clone induced a significant increase in ⁸⁶Rb⁺ uptake that was Cl^– dependent, Na⁺ dependent, and bumetanide sensitive, indicating that it encodes for a Na⁺-K⁺-2Cl^– cotransporter. Because this investigative group previously denominated the thiazide-sensitive Na⁺-Cl^– cotransporter cDNA clone from flounder urinary bladder as flTSC (137), the identified cDNA clone from renal outer medulla was denominated rBSC1 for rat bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter 1; thus the apical Na⁺-K⁺-2Cl^– cotransporter encoded by SLC12A1 gene is indistinctly known as BSC1 or NKCC2. Hereafter I will refer to this cotransporter as BSC1/NKCC2. After initial cloning of BSC1/NKCC2 from rat and rabbit kidney, the same cotransporter was identified at the molecular level from mouse and human kidney (Table 1). Igarashi et al. (187) identified a 4,655-bp clone from a mouse renal outer medulla library containing a 3,285 ORF that encodes a 1,095-amino acid transporter that is 93 and 97% identical to rabbit and rat BSC1/NKCC2, respectively. By Northern blot and in situ hybridization analysis, they showed that in mouse, BSC1/NKCC2 is also expressed exclusively in kidney, including developing kidney from the hybridization signal in mouse embryo detected only in metanephros. Finally, Simon et al. (375) reported the primary structure of human BSC1/NKCC2 as part of their study of SLC12A1 gene involvement in Bartter's disease. Human BSC1/NKCC2 is 95% identical to rabbit and 93% to rat or mouse BSC1/NKCC2. As shown in Figure 1, the proposed topology of BSC1/NKCC2 is very similar to that of TSC or BSC2/NKCC1. A central hydrophobic domain of ~475 residues containing 12 putative membrane-spanning segments is flanked by two predominantly hydrophilic domains: a short amino-terminal domain of ~165 amino acids and a long carboxy-terminal domain of ~450 residues. Both domains are presumably located within the cell and contain several putative PKA and protein kinase C (PKC) phosphorylation sites. Central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites.

Molecular diversity in electroneutral cotransporter family is increased due to existence of alternative splicing isoforms or variants. At least six isoforms of BSC1/NKCC2 are expressed in mouse kidney due to combination of two alternatively splicing mechanisms (Fig. 3) (135, 290). The first was described by Payne and Forbush during cloning of rabbit Na⁺-K⁺-2Cl^– cotransporter (311) and was also observed to be present in mouse (187), rat (447), and human (375) kidney. This splicing mechanism is due to presence of three mutually exclusive cassette exons of 96 bp designated A, B, and F, which encode for 32 amino acid residues corresponding to the second half of the putative transmembrane domain TM2 and the contiguous intracellular loop between TM2 and TM3 (Fig. 3). This splicing mechanism produces three BSC1/NKCC2 proteins that are identical, with the exception of the 32 amino acids encoded by A, B, or F cassettes. Existence of an isoform containing exons A and F together was suggested by Yang et al. (447) following amplification of a DNA band for such an isoform by PCR; nonetheless, its real existence as a protein was not addressed. BSC1/NKCC2 orthologs for isoforms A and F were also identified at the molecular level by Gagnon et al. (134) from Squalus acanthias (shark) kidney. Interestingly, no isoform B is expressed in shark kidney, which lacks a well-developed juxtaglomerular complex. Because there are data to support that B isoform could be the Na⁺-K⁺-2Cl^– sensing isoform in macula densa cells (see sect. VB), this observation suggests that B exon arose later in the evolutionary chain, when complete tubuloglomerular feedback mechanisms were developed. Interestingly, the AF isoform was also observed by Gagnon et al. (134) in shark kidney, together with other spliced variants lacking transmembrane segment 8; however, all these variants were not functional when expressed in HEK-293 cells or in X. laevis oocytes.

View larger version (17K): [in this window] [in a new window]   FIG. 3. Splice variants of the mouse apical, renal specific Na+-K+-2Cl– cotransporter BSC1/NKCC2. The central hydrophobic domain containing 12 putative transmembrane segments is flanked by predominantly hydrophilic amino- and carboxy-terminal domains. Two glycosylation sites are depicted in the extracellular loop between membrane segments 7 and 8. The region of transmembrane domain 2 and the interconnecting segment between transmembrane domains 2 and 3 that are highlighted in green depict the mutually exclusive cassette exons A, B, or F. The long isoform BSC1-L contains 329 amino acid residues in the carboxy-terminal domain (highlighted in red) that are not present in the shorter isoform BSC1-S, which contains 55 unique residues at the end of the carboxy-terminal domain (highlighted in blue). Arrows show putative protein kinase A phosphorylation sites unique to each isoform.

3. The basolateral bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter

SLC12A2 gene encodes the Na⁺-K⁺-2Cl^– cotransporter that is ubiquitously expressed. This cotransporter is present in both epithelial and nonepithelial cells. In epithelial cells, its expression is confined to basolateral membrane, some examples of which are gills, trachea, intestine, and renal collecting duct. The sole exception is choroid plexus, in which this cotransporter is expressed in apical membrane (326). In 1994, the same two independent research teams who cloned BSC1/NKCC2 also identified cDNA encoding the basolateral cotransporter. Xu et al. (440) using monoclonal antibodies J3 and J7 that recognize epitopes in the carboxy-terminal half of the cotransporter (256) were able to isolate from a shark rectal gland cDNA library a single 5,260-bp cDNA clone that encoded a protein of 1,191 amino acid residues. When this clone was transfected into HEK-293 cells, a robust bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter mechanism was induced, exhibiting functional properties similar to those previously shown as present in shark rectal gland (127). As shown in Table 1, full-length cDNA clone was denominated NKCC1. Tissue distribution analysis by Northern blot revealed presence of NKCC1 transcripts in all tissues. Also in 1994, this team was also able to identify the mammalian ortholog from a human colonic (T84 epithelial cell line) cDNA library using a probe constructed from shark NKCC1 cDNA. ORF of 3,036 bp predicted that human NKCC1 is a 1,212-amino acid residue cotransporter with molecular mass of 132 kDa, which by Northern blot analysis was also shown to be expressed in most tissues. Simultaneously, a cDNA encoding the basolateral Na⁺-K⁺-2Cl^– cotransporter was identified from a mouse inner medullary collecting duct cell line (mIMCD-3) cDNA library by Delpire et al. (80), using degenerative primers that were designed over highly homologous regions of putative transmembrane domains 1 and 10 of TSC and BSC1 (136, 137). Because these authors previously denominated thiazide-sensitive Na⁺-Cl^– cotransporter as TSC (137) and apical renal-specific bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter BSC1 (136), basolateral isoform was denominated BSC2. Hereafter I will refer to this cotransporter as BSC2/NKCC1.

As shown in Figure 1, the proposed topology of BSC2/NKCC1 is similar to that of TSC or BSC1/NKCC2. The central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites, both of which are conserved in BSC1/NKCC2, but only one of which is present in TSC. BSC2/NKCC1 is the only member of the family to date for which proposed topology is supported by experimental data. Gerelsaikhan and Turner (140) studied transmembrane topology of NKCC1 using an in vitro translation system designed to test membrane-insertion properties of putative membrane-spanning helices, by fusing each with a carboxy terminal reported sequence containing multiple N-linked glycosylation sites. With this strategy, they observed that NKCC1 is indeed composed of 12 membrane-spanning segments. The first eight segments exhibit the classical ~20 residue length helices, while segments 9 and 10, as well as segments 11 and 12 together are ~36 residues in length, suggesting that these transmembrane segments form a hairpin-like structure in the membrane or take up either a nonhelical or a partial helical structure. Presence of asparagine and proline residues in the middle between segments 9 and 10, and segments 11 and 12 are in accord with the possibility that hairpin helices are present (282).

As shown in Table 1, basolateral Na⁺-K⁺-2Cl^– cotransporter BSC2/NKCC1 has been identified at the molecular level from other three species including rat (284), Bos taurus (bovine) (448), and Anguilla anguilla (eel) (69). The case of eel is interesting because Cutler and Cramb (69) identified two different genes encoding highly homologous NKCC1 isoforms that were denominated NKCC1a and NKCC1b. Degree of identity at amino acid level between both cotransporters is ~80%. The majority of the divergence is located in the first 80–90 residues of the amino-terminal domain in which degree of identity is not >35%; however, the remainder of the sequence exhibits an identity of 85%. NKCC1a of ~13 kb was present in all tissues, whereas NKCC1b of 6 kb was observed only in brain RNA. The authors proposed that existence of two NKCC1 genes in eel fits with the paradigm that a certain percentage of the teleost genome underwent ancient duplication. Functional differences between both cotransporters have not been explored.

Molecular diversity in BSC2 is also increased by existence of one alternatively spliced isoform. As part of their cloning and characterization of mouse SLC12A2 gene, Randall et al. (332) intentionally searched for alternative spliced isoforms by PCR-amplifying segments containing two to three exons. A spliced variant was detected from mouse brain total RNA; it lacked the 48 bp that correspond to entire exon 21. Thus 16 residues within the carboxy terminal are not present. Existence of spliced transcript was confirmed by RNase protection assay. Analysis of distribution within brain showed that transcript lacking exon 21 is present in all areas examined except in choroid plexus, in which the only isoform containing exon 21 is expressed. This spliced variant, however, was also observed in human ocular-trabecular meshwork cells; in addition, with the use of a kinetic PCR strategy it was observed that exon 21-lacking isoform is expressed in several human tissues, with an up to 68-fold variation in isoforms ratio among 14 tested tissues. Brain was the only tissue in which the isoform lacking exon 21 was significantly more abundant than the longer one (418). Spliced variant performs as an Na⁺-K⁺-2Cl^– cotransporter (418), but its physiological significance is not yet known. However, it is important to note that the absence of the exon 21 sequence removes the sole putative PKA site present in the entire BSC2 sequence.

B. K⁺-Coupled Chloride Cotransporters

The K⁺-Cl^– cotransport mechanism was first described in low-potassium sheep red blood cells as a swelling- and N-ethylmaleimide (NEM)-activated K⁺ efflux pathway (95, 237). Cotransport of K⁺ and Cl^– is interdependent, with a 1:1 stoichiometry and low-affinity constants for both ions (for excellent reviews, see Refs. 62, 235). Although red blood cells have remained as the primary model tissue for this class of ion transport, functional and physiological evidence for existence of a similar K⁺-Cl^– cotransporter was soon reported in several cells and tissues including neurons (346), vascular smooth muscle (4), endothelium (317), epithelia (12, 155), heart (445), and skeletal muscle (430), suggesting that K⁺-Cl^– cotransport is implicated not only in regulatory volume decrease, but also in transepithelial salt absorption (12), renal K⁺ secretion (108), myocardial K⁺ loss during ischemia (445), and regulation of neuronal Cl^– concentration (346). Molecular identification of genes encoding K⁺-Cl^– cotransporters was possible due to their homology with Na⁺-coupled Cl^– cotransporters. Four genes encoding K⁺-Cl^– cotransporters were identified as part of the SLC12 family; these genes are known as SLC12A4, SLC12A5, SLC12A6, and SLC12A7 and encode the isoforms known as KCC1, KCC2, KCC3, and KCC4, respectively.

1. The K⁺-Cl^– cotransporter KCC1

Identification of four K⁺-Cl^– cotransporter genes was possible due to the so-called in silico cloning strategies (291) that were based on identification of sequences in Genebank, particularly the expressed sequence tag databases (dbEST), which were initiated in 1992 and that underwent dramatic enlargement throughout the 1990s. Molecular identification of human KCC1 was based on finding several human dbEST that were <50% identical to BSC1/NKCC2, BSC2/NKCC1, or TSC, indicating that EST sequences belonged to an unidentified member of the family. Therefore, probes derived from dbEST were used by Gillen et al. (142) to isolate full-length clones from human, rat, and rabbit kidneys that encode a membrane protein of 1,085 amino acid residues (see Table 2) that is expressed in all tested tissues as a predominant 3.8-kb transcript. Stable HEK-293 cells transfected with rabbit KCC1 cDNA exhibited ⁸⁶Rb⁺ uptake and efflux mechanisms compatible with known characteristics of the red blood cell K⁺-Cl^– cotransporter, i.e., ⁸⁶Rb⁺ transport induced by rabbit KCC1 was Na⁺ independent, Cl^– dependent, furosemide sensitive, and activated by NEM or cell swelling.

As shown in Table 2, after initial cloning of KCC1 cDNA by Gillen et al. (142), KCC1 orthologs have been cloned from other species. Pellegrino et al. (316) using a homology PCR-based approach isolated cDNA clones encoding KCC1 from human erythroleukemia cell line K256 and also from mouse erythroleukemia cell line MEL. Degree of identity among human, rat, rabbit, and mouse KCC1 is ~96%. Interestingly, KCC1 was not present in human or mouse reticulocytes but was present during the early stages of erythroleukemia cell differentiation, suggesting that level of expression of KCC1 mRNA may play a role in early stages of erythroid maturation. Pellegrino et al. (316) also isolated two distinct mRNAs exhibiting different ends of the protein; one mRNA contained a stop codon at residue 1,012, resulting in a 73-amino acid truncated protein, and the second contained distinct sequence after residue 1,056 and resulted in a 23-amino acid truncated protein. It was suggested that both could be alternatively spliced isoforms; however, no further actions were taken to support this hypothesis. Finally, KCC1 has also been identified from Sus Scorfa (pig) and from Caenorhabditis elegans, exhibiting 94 and 42% identity, respectively, with other mammalian KCC1 orthologs. Both clones were shown in HEK-293 transfected cells to encode a K⁺-Cl^– cotransporter (180).

2. The K⁺-Cl^– cotransporter KCC2

Finding two EST from human brain exhibiting 35% identity with human BSC2/NKCC1 allowed Payne et al. (313) to amplify by PCR a 286-bp cDNA fragment from rat brain that was then used as a template to prepare a ³²P-DNA random primed probe to screen a rat brain cDNA library under low-stringency conditions. From 19 clones isolated, 7 were KCC1 and 12 corresponded to a new closely related cDNA named KCC2. The 5,566-bp full-length clone encodes a protein of 1,116 amino acid residues with predicted molecular mass of 123 kDa that is 67% identical to KCC1. As shown in Table 2, a similar cDNA was later isolated and sequenced from mouse as part of a large-scale project launched to identify all human and mouse ORFs by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391). Hydrophobicity analysis revealed a protein with 12 putative-transmembrane segments with a topology similar to KCC1 (Fig. 1) in which the glycosylated extracellular loop is located between transmembrane segments 5 and 6. Northern blot analysis revealed that a single transcript of ~5.6 kb was expressed only in poly(A)⁺ RNA from the central nervous system (CNS), indicating that KCC2 is a brain-specific gene. By PCR analysis, several rat nervous system-derived cell lines such as primary astrocytes, glioma cell line, and pheochromocytoma cell line were positive for KCC1 but negative for KCC2. In addition, in situ hybridization analysis revealed that KCC2 is present in all layers of cortex, all areas of hippocampus, and the granular layer of the cerebellum, whereas white matter was devoid of any signal, suggesting that KCC2 is expressed exclusively in neurons.

The KCC2 cotransporter has been also isolated and sequenced from other two species. Human KCC2 cDNA was isolated by Song et al. (380) using a PCR-based homology approach. As shown in Table 2, a single 5,907-bp cDNA was isolated that encodes a 1,116-residue protein that is 99% identical to rat KCC2. Differentiated NT2-N cells with retinoic acid exhibited expression of KCC2, corroborating the presence of this transcript in a neuronal-derived cell line. KCC2 cDNA has been also isolated and sequenced from mouse by means of a high-throughput sequence study designed to identify gene-coding variants within alcohol-related QTLs in a mouse model of alcohol addiction (102) and also by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391).

3. The K⁺-Cl^– cotransporter KCC3

Three groups simultaneously identified a third gene encoding a K⁺-Cl^– cotransporter (SLC12A6) from human mRNA by means of two different strategies. Hiki et al. (178) used a differential display PCR strategy in human umbilical vein endothelial cells (HUVEC) designed to identify transcripts that exhibited change in expression level after cells were treated with vascular endothelial cell growth factor (VEGF). A consistent upregulated band was sliced off and used as a probe to isolate corresponding full-length cDNA from a HUVEC library that corresponded to a putative membrane transporter with 77% identity with KCC1 and 73% with KCC2; thus isolated cDNA clone was named KCC3 and encodes a protein of 1,099 amino acid residues with a hydropathy profile identical to that of KCC1 and KCC2 (Fig. 1). It was shown in the same study in transfected HEK-293 cells that KCC3 performed as a furosemide-sensitive K⁺-Cl^– cotransporter that exhibited, however, no response to hypotonicity. The new gene was located at human chromosome 15q13 and was shown to be expressed in several tissues including brain, kidney, and liver. Simultaneously, Mount et al. (292) following the in silico strategy identified several human ESTs that were useful to isolate two new members of K⁺-Cl^– cotransporter subfamily that were named KCC3 and KCC4. These proteins exhibited ~70% identity with KCC1 and KCC2. KCC3 cDNA was isolated from a human muscle cDNA library, and Northern blot analysis revealed variable expression of two 6- to 7-kb bands in several tissues, suggesting the possibility of alternative splicing. KCC3 was also isolated by Race et al. (331) following the in silico strategy from a human placenta cDNA library. These authors, using transfected HEK-293 cells, showed that KCC3 encodes a furosemide-sensitive and an NEM-activated K⁺-Cl^– cotransporter that exhibited a slight but significant activation by hypotonicity. As shown in Table 2, full-length KCC3 cDNA isolated by Mount et al. (292) and by Race et al. (331) encodes a 1,150-amino acid residue cotransporter. The difference with the 1,099-residue protein from Hiki et al. (178) resides in length and sequence of the amino-terminal domain, due to the presence of two alternative first exons in the SLC12A6 gene with transcriptional initiation at separate promoters, which were denominated as exon 1a and exon 1b, thus generating the terminology of KCC3a and KCC3b for long and short isoforms, respectively (315). Exon 1a encodes 90 amino acids not present in the 39-residue exon 1b. mRNA encoding KCC3a is widely expressed, with abundant message by Northern blot analysis in brain, kidney, muscle, lung, and heart, while the KCC3b transcript is more abundant in kidney than in any other tissue. Interestingly, there are several potential phosphorylation sites for PKC (292) within the 51 amino acid residues present in KCC3a (exon 1a) that are thus not present in KCC3b (exon 1b) (178), suggesting that these isoforms are subjected to different posttranslational regulation. As discussed in section IIIF, KCC3a and KCC3b isoforms perform as hypotonically activated K⁺-Cl^– cotransporters when X. laevis oocytes were used as the heterologous expression system.

4. The K⁺-Cl^– cotransporter KCC4

There is a fourth gene encoding an isoform of the K⁺-Cl^– cotransporter, which was identified by Mount et al. (292) from mouse and human kidney mRNA by PCR using several ESTs to guide the design of appropriate primers. KCC4 cDNA encodes a protein of 1,083 amino acid residues with a hydropathy profile similar to that of other K⁺-Cl^– cotransporters (Fig. 1). The degree of identity with KCC1, KCC2, and KCC3 is 67, 72, and 67%, respectively. KCC4 is expressed in several tissues, with higher levels in heart and kidney and very low levels in brain. Within the CNS, the main localization of KCC4 protein is on cranial nerves (204). Functional expression in X. laevis oocytes demonstrated that KCC4 encodes a K⁺-Cl^– cotransporter that can be activated by incubation in hypotonicity or after NEM exposure (275, 292). KCC4 cDNA has also been isolated from rabbit kidney by Velázquez and Silva (414) and encodes a 1,106-amino acid protein that contains 23 extra residues not present in mouse or human orthologs. These extra residues are located within the amino-terminal domain as two separate fragments of 11 and 12 residues. No studies were done to demonstrate if this is due to alternative splicing or is a cloning artefact.

C. Orphan Members

Two orphan members of the cation-chloride cotransporter family have been described. Caron et al. (49) identified human ESTs with 25% degree of identity with KCCs, BSC1/NKCC2, BSC2/NKCC1, and TSC, suggesting that the gene encoding such a transcript could be a distant but related member of the family. A ZAP II/human heart cDNA library was screened using a random primed ³²P-DNA probe constructed from EST under low-stringency conditions until a 3,276-bp full-length transcript clone was isolated and named CIP for cotransporter interacting protein (GeneBank accession no. AF284422). A single ORF of 2,742 bp predicted a protein of 915 amino acid residues with a molecular mass of 96 kDa. As shown in Figure 1, hydropathy analysis of CIP protein revealed a topology that more closely resembles KCC cotransporters, because the long glycosylated extracellular loop is located between transmembrane segments 5 and 6. CIP amino- and carboxy-terminal domains are 44 and 370 amino acids in length, respectively. Northern blot analysis revealed wide distribution along tissues, and functional expression flux studies were performed in both HEK-293 cells and X. laevis oocytes transfected with cDNA and cRNA, respectively. Unfortunately, no increase in ²²Na⁺, ⁸⁶Rb⁺, or ³⁶Cl^– was observed under any multiple experimental approaches tested. For this reason, CIP is considered an orphan member of the family because its transport substrate is not known. However, coinjection experiments that were performed revealed that BSC2/NKCC1, but not BSC1/NKCC2 or KCC1, was significantly and reproducibly inhibited when coinjected with CIP; for this reason the new clone was denominated CIP for cotransporter interacting protein. Coimmunoprecipitation experiments suggested that a potential explanation for CIP effects upon NKCC1 involves physical interaction between both proteins. The gene SLC12A9 encoding this cotransporter was located to human chromosome 7q22.

Finally, the most recent and distant member of the family has been provisionally denoted SLC12A8 (289) (GeneBank accession no. AF345197). This is a membrane protein that is much shorter than the remainder of family members (714 amino acids), and it is ~30% identical to BSC1/NKCC2, with particular conservation of predicted transmembrane segments 1, 2, 6, and 7. Predicted topology (Fig. 1) is unique in the family because there is a short intracellular amino-terminal domain followed by 11 membrane segments, with a glycosylated carboxy-terminal tail. Transport function is not yet known because heterologous expression in X. laevis oocytes failed to detect significant activity in transport of ³⁶Cl^–, ⁸⁶Rb⁺, and ²²Na⁺ and revealed no interaction with coinjected TSC, BSC1/NKCC2, or KCC4, suggesting that this protein does not form heterodimers with other family members. There are clear orthologs within Drosophila and C. elegans genomes, and interestingly, this gene has been identified as a psoriasis-susceptibility candidate gene on chromosome 3q21 (176).

D. Genes and Promoter Characteristics

1. Na⁺-coupled chloride cotransporters

The gene encoding the renal-specific bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter (SLC12A1) has been mapped in humans at chromosome 15 (375), in rat at chromosome 3 (423), and in mouse at chromosome 2 (330). SLC12A1 in humans encompasses 80 kb and contains 26 exons (Table 3). Intron range spans from 120 bp to 15 kb. A GT dinucleotide repeat within the gene is highly polymorphic with 42% heterozygosity in 50 unrelated subjects (375). SLC12A1 promoter region has been cloned from mouse genomic DNA (188). It was first shown in this study, using nuclear run-off assays, that BSC1/NKCC2 kidney-specific expression is due to regulation at the level of initiation of gene transcription and not at posttranscriptional regulation. Subsequently, the promoter was cloned, and transcription initiation was defined as –280 bp of the 5' start codon. It was observed, however, that in mouse SLC12A1, there is a first exon of 34 bp in length that is noncoding, followed by a first intron of 1,101 bp and a second exon containing the translation start codon. Cloned promoter is composed of 2,255 bp, and sequence analysis revealed a TATA box located at position –29 and consensus recognition sites for several transcription factors, of which the most interesting could be a binding site for HNF-1 at –211 bp. In developing mouse kidney, expression of HNF-1 precedes expression of BSC1/NKCC2 (239), and this factor has been implicated in regulation of tissue-specific expression in liver, pancreas, kidney, and intestine. One example is renal epithelium-specific expression of the Ksp-cadherin that is due to interaction with transcription factors NHF-1 and NHF-1 (21). In this regard, transfection of TALH-derived cells with pGL3B-NKCC2 construct, that contained 2,255 bp of SLC12A1 promoter region fused to a luciferase reporter gene, resulting in a 130-fold increase in luciferase activity, while transfection of NIH 3T3 cells resulted in no activity. With the use of TALH-derived cells, it was demonstrated that deletion of –2,255 to –1,529 bp produced an approximately threefold increase in luciferase activity, suggesting that this region contains negative regulatory elements. Deletion from –1,529 to –469 bp had no further effect, but deletion from –469 to –190 resulted in 76% reduction of promoter activity, suggesting that this region contains positive regulatory elements. HFN-1 binding site is located in this region. Finally, a cAMP response-element binding protein is located at nucleotide –1,111. This site could be important because it is known that Na⁺-K⁺-2Cl^– cotransporter activity in TALH is increased by vasopressin (171, 280) and that chronic administration of 1-desamino-[8-d-arginine]vasopressin (DDAVP) to Sprague-Dawley and Brattleboro rats is associated with increase in BSC1/NKCC2 abundance at protein level (209). It is not known whether this effect is at the regulation of gene transcription or by increasing protein stability. The effect of DDAVP on mRNA levels, however, has not been reported.

The gene encoding thiazide-sensitive Na⁺-Cl^– cotransporter (SLC12A3) has been mapped at chromosomes 16q13 in humans (265, 377), 19p12–14 in rats (400), and 8 in mice (308). As shown in Table 3, human SLC12A3 is 55 kb long and contains 26 exons (377). All exon-intron boundaries have the conventional 5'-GT and 3'-AT consensus splice sites. There is a polymorphic genetic marker of a GT-dinucleotide repeat within SLC12A3 gene that exhibited heterozygosity of 48% in 45 unrelated Caucasian subjects. SLC12A3 promoter region has been cloned from humans (257) and rat (400) genomic DNA. In humans, transcription initiation is confined to an area from –18 to –6 upstream of the translation start codon, and maximum promoter activity in mouse distal convoluted cell line (MDCT) (257) transfected with pCAT3 constructs was obtained with construct containing 1,019 bp of the 5'-flanking region; however, 75% of activity was observed with a promoter containing only 134 bp of the 5'-flanking region. Sequence analysis of promoter revealed the presence of a TATA element, two Sp binding sites, and potential binding sites for NF-1/CTF or NY-I/CP-I. Consistent with the general belief that TSC exhibits kidney-specific expression, the promoter region in humans displayed repressor activity in Chinese hamster ovary-derived cell line CHO-K1, which requires the presence of two Sp binding sites. Promoter activity in MDCT cells transfected with a pACT3 construct containing –1,019 to +1 of the 5'-flanking region was shown to inhibit transcription in response to acidification of the extracellular medium, but not to hypertonicity or presence of mineralocorticoid DOCA. The observation that acidosis inhibited promoter activity is consistent with a marked fall in renal cortical abundance of TSC assessed by either Western blot of renal cortical proteins (211) or by [³H]metolazone binding to plasma membranes from renal cortex (119) of rats exposed to chronic NH₄Cl loading.

With the use of luciferase reporter gene analysis in HEK-293 cells, maximal activity of rat SLC12A3 promoter was obtained with –2,093 bp of the 5'-flanking region; nonetheless, most activity was found present using a –580-bp fragment. The transcription initiation site in the rat was located 18 bases upstream of the start codon. Several putative consensus transcription factor recognition sequences were observed, including a TATA box in position –42, three SRY, five Pit-1, and two Sp1 binding sites, two glucocorticoid response elements (GRE), one cAMP response element (CRE), and an HFH-3 binding site. Rat promoter displays repressor activity in a human hepatocyte cell line (HepG2) and a rat vascular smooth muscle cell line (A10), but not in human embryonic kidney cells HEK-293 (400). In addition, transgenic rats harboring a construct containing 5'-flanking region of rat SLC12A3 promoter fused to LacZ gene displayed immunoreactivity against -galacosidase exclusively in DCT (400). One potential explanation for TSC kidney-specific expression is presence of the HFH-3 binding site in –393 bp of rat promoter. The HFH-3 transcription factor belongs to HFH/winged helix factor family, and its expression in mammalian kidney has also been shown to be restricted to the epithelium of DCT (305). Members of the HFH/winged family are known to be involved in tissue-specific gene expression and differentiation during embryonic development (228); thus HFH-3 transcription factor could be involved in defining TSC tissue-specific expression. Consistent with this view, Taniyama et al. (400) showed that overexpression of HFH-3 transcription factor stimulated activity of the 5'-FL/rTSC promoter construct in HepG2 cells, assessed by luciferase activity, and that point mutations in HFH-3 binding site on rTSC promoter were associated with marked loss of HFH-3 transcription factor effect. Stimulation, however, was only approximately threefold over activity observed in mock transfected HepG2 cells, while in HEK-293 5'-FL/TSC transfected cells, luciferase activity was 25-fold over mock-transfected cells, suggesting that other elements are probably involved in defining TSC gene expression.

2. The K⁺-coupled chloride cotransporters

Ubiquitously expressed K⁺-Cl^– cotransporter KCC1 gene SLC12A4 has been localized on chromosomes 16q22 in humans (231) and on chromosome 8 in mice (392) and encompasses a region of 23 kb in the genome and is composed of 24 exons (180). As shown in Table 3, this is the smallest gene of the electroneutral cotransporter family. Intron length ranges from 75 bp to 4.5 kb, while the exon range spans 95–242 bp. All intron-exon boundaries possess conventional 5'-GT and 3'-AT consensus splice sites. In contrast, gene encoding KCC1 in Caenorhabditis elegans is composed of 9 exons and 10 introns that encompass 3.5 kb (180). Zhou et al. (451) recently screened a human genomic BAC library and identified a 1,938-bp KCC1 promoter. A single transcription initiation site was located 121 bp before the first methionine encoding codon ATG. KCC1 promoter lacks TATA and CCAAT consensus sequences but contains one GATA-1 consensus site, two AP-2 sites, and three GC/CACC binding-related proteins that are motifs for several transcription factors including Sp-1. Transfection of different size promoters (–1938, –720, and –369) with luciferase reporter into K562 and HeLa cells demonstrated that promoter is active in both erythroid and nonerythroid cells. Finally, mutations designed to eliminate AP-2 sites reduced promoter activity by one-half, and those in which consensus sequences InR and DPE are eliminated reduced activity by >10-fold.

Neuronal-specific K⁺-Cl^– cotransporter KCC2 gene SLC12A5 has been mapped at chromosome 20q13 in humans (354, 380) and at chromosome 5 in mice (354) (Table 3). Human SLC12A5 encompasses 24 coding exons spread over ~30 kb of genomic DNA. Exons 21 and 22 encode a carboxy-terminal insertion unique to KCC2 discussed later. All intron-exon boundaries obey GT-AG (380). Mean exon size is 140 bp, ranging from 45 to 242 bp. The SLC12A5 promoter region has not been studied in detail. However, it is known that neuron-restricted expression pattern in KCC2 is at least due in part to the presence of a neuronal-restrictive silencing element (NRSE). A genomic clone containing ~7 kb of KCC2 5'-flanking region, exon 1, and ~11 kb of downstream sequence revealed that mouse KCC2 gene contains the sequence TTCAGCACCACGGACAGCGCC within intron 1 (205). This sequence was also observed within intron 1 in humans (380) and is 80% homologous to consensus site for a neuronal-restrictive silencing factor binding (NRSF). This NSRF is known to be responsible for negative transcriptional regulation of genes in nonneuronal cells (360). Mouse putative NRSE contains four mismatched nucleotides when compared with classical NRSE; however, three have been previously shown to be nonessential for NRSF binding (360). In addition, Karadsheh and Delpire (205) observed that the 21-bp fragment containing the putative NRSE was able to interact with proteins isolated from C17 nonneuronal cells and that addition of cold NRSE fragment displaced the binding. In addition, in a luciferase gene reported assay carried out in C17 cells, investigators observed that luciferase activity yielded by KCC2 promoter alone was completely prevented with KCC2 promoter construct also containing NSRE sequence.

SLC12A6 and SLC12A7 genes that encode KCC3 and KCC4 isoforms of K⁺-Cl^– cotransporters have been located at human chromosomes 15q13–14 and 5p15.3, respectively (178, 292). To date, however, complete gene or promoter regions have not been reported. Similarly, SLC12A9 cDNA encoding CIP was cloned from a human heart cDNA library, and the gene was located at human chromosome 7q22. The complete gene or promoter regions have not been described. Finally, by BLAST search analysis, the gene encoding SLC12A8 has been localized at human chromosome 3q21–22.

E. Phylogenetic and Sequence Comparison

Figure 4 shows the phylogenetic tree, and Table 4 shows the degree of identity obtained from alignment analysis of all members of electroneutral cotransporter family. Alignment was performed according to the Clustal W method using DNASTAR MegaAlign software. For this analysis, predicted sequences of human cotransporter proteins were used. As shown in Figure 4, two main branches are clearly separated: one branch is composed of cotransporters that utilize Na⁺ as cation in the coupled process, regardless of their use of K⁺, and include BSC1/NKCC2, BSC2/NKCC1, and TSC, while the remaining branch is composed of cotransporters that use K⁺ as a unique cation coupled with Cl^– include KCC1, KCC2, KCC3, and KCC4. As seen in Table 4, degree of identity between members of one branch with the other is ~25%. The K⁺-coupled Cl^– cotransporters branch is subdivided into two subfamilies: one composed of KCC1 and KCC3 that exhibit ~75% identity, and the other of KCC2 and KCC4 that share ~72% of amino acid residues. Identity between both KCC subfamilies is ~65%. Finally, overall identity of orphan members CIP and CCC9, between the two, and with the remainder of the family is ~20%.

View larger version (12K): [in this window] [in a new window]   FIG. 4. Phylogenetic tree of the electroneutral cation-coupled chloride cotransporter family SLC12. Numbers indicate degree of identity.

The carboxy-terminal domain (defined as the segment extending from first amino acid residue after transmembrane segment 12 to the end of the protein) is more conserved in the KCC branch than in Na⁺-coupled cotransporters. As shown in Table 4, among KCCs the percentage of identity in carboxy-terminal domain is similar to the degree observed within central hydrophobic domain, while in Na⁺-coupled cotransporters the identity is lower. The length of this domain ranges from 413 to 480 residues. An alternatively splicing isoform in BSC2/NKCC1 due to lack of 21 residues of the carboxy-terminal domain has been described. Consequences of the splicing are not yet known (332). As previously discussed, there is also evidence for a shorter carboxy-terminal domain-spliced variant in BSC1/NKCC2 (290). Modifications in the carboxy-terminal sequence and length confer upon the cotransporter with interesting changes in functional properties that are discussed in section IIIB. Finally, there are two unique regions within the carboxy-terminal domain. One in the Na⁺-K⁺-2Cl^– cotransporter of ~60 amino acid residues that is not present in TSC, which exhibits a degree of identity <13% between BSC1/NKCC2 and BSC2/NKCC1; thus this is a unique region in both cotransporters. The presence of several putative phosphorylation sites, including one putative PKA site in BSC2/NKCC1, suggests that this region may be associated with specific regulatory properties of each cotransporter. The remaining unique region belongs to KCC2. There are 73 amino acid residues in the carboxy-terminal domain of KCC2 that are not present in KCC1, KCC3, and KCC4. This region also contains several putative regulatory sites, including one for PKA phosphorylation.

	III. FUNCTIONAL PROPERTIES

Top Previous Next References

 
Since the discovery of these membrane transport systems, several investigators have studied in different cells and organisms the functional characteristics of the basolateral Na⁺-K⁺-2Cl^– and K⁺-Cl^– cotransporters. Characterization of the same cotransport system in several different cells has yielded important functional differences in which it is difficult to define whether they are related to the cotransporter protein itself, to species differences in the protein, or to the environment in which it was studied. In the case of K⁺-Cl^– cotransporter, most functional characterization has been carried out in erythrocytes an